Download: STK FA Profile Interaction1 Interaction2
| Name: | SNORD66 |
| ID: | snoID_0080 |
| Chr: | chr3 |
| Strand: | + |
| Gene start: | 184043484 |
| Gene end: | 184043559 |
| Expression start: | 184043484 |
| Expression_end: | 184043557 |
| Alias name: | SNORD66 |
| Type: | CD |
| Source: | HUGO |
| Expression: | 1644151 |
| Host gene: | EIF4G1 |
| overlapping gene: | SNORD66 |
| Rfam ID | RF00572 |
| p-value: | 1.5e-26 |
| RNA family name: | SNORD66 |
| RNA family: | Small nucleolar RNA SNORD66 |
| comment: | sdRNA with mi-RNA like capability |
| Conservation: | Tetrapodes and Teleostes |
| Sequence: | TTCCTCTGATGACTTCCTGTTAGTGCCACGTGTCTGGGCCACTGAGACACCATGATGGAACTGAGGATCTGAGGAA |
| Boxes: | ATGATGG_52_CTGA_42_CTGATGA_6_CTGA_69 |
| Reported1 (R): | - |
| Human1 (H): | 18S-1310 |
| Conserved1 (C): | 18S-1310 |
| Selected1: | CH:18S-1310 |
| ICI1 | 1.2 |
| special1 | * |
| Reported2 (R): | 18S-1272 |
| Human2 (H): | 18S-1272 |
| Conserved2 (C): | 18S-1272 |
| Selected2: | RCH:18S-1272 |
| ICI2 | 2.01 |
| special2 | |
| Reported3 (R): | |
| Human3 (H): | |
| Conserved3 (C): | |
| Selected3: | |
| ICI3 | |
| special3 | |
| Reported4 (R): | |
| Human4 (H): | |
| Conserved4 (C): | |
| Selected4: | |
| ICI4 | |
| special4 |