Download: STK FA Profile Interaction2
| Name: | SNORD60 |
| ID: | snoID_0075 |
| Chr: | chr16 |
| Strand: | - |
| Gene start: | 2205024 |
| Gene end: | 2205106 |
| Expression start: | 2205106 |
| Expression_end: | 2205027 |
| Alias name: | SNORD60 |
| Type: | CD |
| Source: | HUGO |
| Expression: | 1856467 |
| Host gene: | RP11-304L19.5 |
| overlapping gene: | SNORD60 |
| Rfam ID | RF00271 |
| p-value: | 4.2e-25 |
| RNA family name: | SNORD60 |
| RNA family: | Small nucleolar RNA SNORD60 |
| comment: | Involved in cholesterol trafficking to endoplasmatic reticulum |
| Conservation: | Tetrapodes and Teleostes |
| Sequence: | AGTCTGTGATGAATTGCTTTGACTTCTGACACCTCGTATGAAAACTGCACGTGCAGTCTGATTATTTAGCAAGACTGAGGCTT |
| Boxes: | CTGATTA_58_ATGA_38_GTGATGA_6_CTGA_75 |
| Reported1 (R): | - |
| Human1 (H): | U4.1-57 |
| Conserved1 (C): | NA |
| Selected1: | NA |
| ICI1 | 0.15 (H) |
| special1 | |
| Reported2 (R): | 28S-4340 |
| Human2 (H): | 28S-4340 |
| Conserved2 (C): | 28S-4340 |
| Selected2: | RCH:28S-4340 |
| ICI2 | 1.82 |
| special2 | |
| Reported3 (R): | |
| Human3 (H): | |
| Conserved3 (C): | |
| Selected3: | |
| ICI3 | |
| special3 | |
| Reported4 (R): | |
| Human4 (H): | |
| Conserved4 (C): | |
| Selected4: | |
| ICI4 | |
| special4 |