Download: STK FA Profile Interaction2
| Name: | SNORD27 |
| ID: | snoID_0072 |
| Chr: | chr11 |
| Strand: | - |
| Gene start: | 62622484 |
| Gene end: | 62622555 |
| Expression start: | 62622555 |
| Expression_end: | 62622488 |
| Alias name: | SNORD27 |
| Type: | CD |
| Source: | HUGO |
| Expression: | 2044443 |
| Host gene: | SNHG1 |
| overlapping gene: | SNORD27 |
| Rfam ID | RF00086 |
| p-value: | 0.00000000000074 |
| RNA family name: | SNORD27 |
| RNA family: | Small nucleolar RNA SNORD27 |
| comment: | sdRNA with mi-RNA like capability |
| Conservation: | Tetrapodes and Teleostes |
| Sequence: | ACTCCATGATGAACACAAAATGACAAGCATATGGCTGAACTTTCAAGTGATGTCATCTTACTACTGAGAAGT |
| Boxes: | GTGATGT_47_CTGA_35_ATGATGA_6_CTGA_64 |
| Reported1 (R): | - |
| Human1 (H): | 28S-2269 |
| Conserved1 (C): | NA |
| Selected1: | NA |
| ICI1 | 0.42 (H) |
| special1 | |
| Reported2 (R): | 18S-27 |
| Human2 (H): | 18S-27 |
| Conserved2 (C): | 18S-27 |
| Selected2: | RCH:18S-27 |
| ICI2 | 1.35 |
| special2 | |
| Reported3 (R): | |
| Human3 (H): | |
| Conserved3 (C): | |
| Selected3: | |
| ICI3 | |
| special3 | |
| Reported4 (R): | |
| Human4 (H): | |
| Conserved4 (C): | |
| Selected4: | |
| ICI4 | |
| special4 |