Download: STK FA Profile Interaction1 Interaction2
| Name: | SNORD50B |
| ID: | snoID_0067 |
| Chr: | chr6 |
| Strand: | - |
| Gene start: | 86387307 |
| Gene end: | 86387377 |
| Expression start: | 86387376 |
| Expression_end: | 86387306 |
| Alias name: | SNORD50B |
| Type: | CD |
| Source: | HUGO |
| Expression: | 2320856 |
| Host gene: | SNHG5 |
| overlapping gene: | SNORD50B |
| Rfam ID | RF00278 |
| p-value: | 4.5e-19 |
| RNA family name: | SNORD50 |
| RNA family: | Small nucleolar RNA SNORD50 |
| comment: | Regulation of chromatin structure |
| Conservation: | Tetrapodes and Teleostes |
| Sequence: | TAATCAATGATGAAACCTATCCCGAAGCTGATAACCTGAAGAAAAATAAGTACGGATTCGGCTTCTGAGAT |
| Boxes: | CTGAAGA_36_CTGA_28_ATGATGA_7_CTGA_65 |
| Reported1 (R): | 28S-2848 |
| Human1 (H): | 28S-2848 |
| Conserved1 (C): | 28S-2848 |
| Selected1: | RCH:28S-2848 |
| ICI1 | 1.17 |
| special1 | |
| Reported2 (R): | 28S-2863 |
| Human2 (H): | 28S-2863 |
| Conserved2 (C): | 18S-1598 |
| Selected2: | RH:28S-2863 |
| ICI2 | 1.02 |
| special2 | |
| Reported3 (R): | |
| Human3 (H): | |
| Conserved3 (C): | |
| Selected3: | |
| ICI3 | |
| special3 | |
| Reported4 (R): | |
| Human4 (H): | |
| Conserved4 (C): | |
| Selected4: | |
| ICI4 | |
| special4 |