Download: STK FA Profile Interaction1 Interaction2
Name: | SNORD50B |
ID: | snoID_0067 |
Chr: | chr6 |
Strand: | - |
Gene start: | 86387307 |
Gene end: | 86387377 |
Expression start: | 86387376 |
Expression_end: | 86387306 |
Alias name: | SNORD50B |
Type: | CD |
Source: | HUGO |
Expression: | 2320856 |
Host gene: | SNHG5 |
overlapping gene: | SNORD50B |
Rfam ID | RF00278 |
p-value: | 4.5e-19 |
RNA family name: | SNORD50 |
RNA family: | Small nucleolar RNA SNORD50 |
comment: | Regulation of chromatin structure |
Conservation: | Tetrapodes and Teleostes |
Sequence: | TAATCAATGATGAAACCTATCCCGAAGCTGATAACCTGAAGAAAAATAAGTACGGATTCGGCTTCTGAGAT |
Boxes: | CTGAAGA_36_CTGA_28_ATGATGA_7_CTGA_65 |
Reported1 (R): | 28S-2848 |
Human1 (H): | 28S-2848 |
Conserved1 (C): | 28S-2848 |
Selected1: | RCH:28S-2848 |
ICI1 | 1.17 |
special1 | |
Reported2 (R): | 28S-2863 |
Human2 (H): | 28S-2863 |
Conserved2 (C): | 18S-1598 |
Selected2: | RH:28S-2863 |
ICI2 | 1.02 |
special2 | |
Reported3 (R): | |
Human3 (H): | |
Conserved3 (C): | |
Selected3: | |
ICI3 | |
special3 | |
Reported4 (R): | |
Human4 (H): | |
Conserved4 (C): | |
Selected4: | |
ICI4 | |
special4 |