Download: STK FA Profile Interaction2
| Name: | SNORD78 |
| ID: | snoID_0004 |
| Chr: | chr1 |
| Strand: | - |
| Gene start: | 173834761 |
| Gene end: | 173834824 |
| Expression start: | 173834823 |
| Expression_end: | 173834762 |
| Alias name: | SNORD78 |
| Type: | CD |
| Source: | HUGO |
| Expression: | 152089963 |
| Host gene: | GAS5 |
| overlapping gene: | SNORD78 |
| Rfam ID | RF00592 |
| p-value: | 6e-22 |
| RNA family name: | SNORD78 |
| RNA family: | Small nucleolar RNA SNORD78 |
| comment: | sdRNA with mi-RNA like capability |
| Conservation: | Tetrapodes and Teleostes |
| Sequence: | GTGTAATGATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGACAAAGGTAACACTGAAGA |
| Boxes: | ATGTAGA_40_CTGA_29_ATGATGT_6_CTGA_58 |
| Reported1 (R): | - |
| Human1 (H): | U4atac.2-104 |
| Conserved1 (C): | NA |
| Selected1: | NA |
| ICI1 | 0.2 (H) |
| special1 | |
| Reported2 (R): | 28S-4593 |
| Human2 (H): | 28S-4593 |
| Conserved2 (C): | 28S-4593 |
| Selected2: | RCH:28S-4593 |
| ICI2 | 1.6 |
| special2 | |
| Reported3 (R): | |
| Human3 (H): | |
| Conserved3 (C): | |
| Selected3: | |
| ICI3 | |
| special3 | |
| Reported4 (R): | |
| Human4 (H): | |
| Conserved4 (C): | |
| Selected4: | |
| ICI4 | |
| special4 |